Pagina 1 di 1

Aplogruppo R1a KMS133

MessaggioInviato: mercoledì 6 giugno 2018, 13:11
da Giovanni Maione
Arrivati oggi i risultati dell'Y-DNA: R1a KMS133
Ho fatto delle ipotesi, ma prima vorrei sapere se qualcuno di voi sa qualcosa in più su questa subclade.

Re: Aplogruppo R1a KMS133

MessaggioInviato: martedì 30 ottobre 2018, 18:53
da Giovanni Maione
Sotto: M417 > Z93 > KMS149
Esiste una subclade profonda KMS132 sotto KMS133, che non ho ancora testato.
ISOGG Haplogroup: R1a1a1b2 (not listed)
Position (hg19): 14593932
Position (hg38): 12482132

Forward Primer: KMS133_F CTGGGATTATAGGCCTGAGG
Reverse Primer: KMS133_R TGTAAAAAGACGGAAATTAGGTGG

Reference: KMS (Muratov et al.) (2014)

Re: Aplogruppo R1a KMS133

MessaggioInviato: domenica 4 novembre 2018, 11:08
da Nessuno
Molto interessante: pare che KMS133 sia condivisa soprattutto da persone di origine slava.

Re: Aplogruppo R1a KMS133

MessaggioInviato: domenica 4 novembre 2018, 14:36
da Giovanni Maione
L'unico KMS133 che ho trovato in risorse disponibili in rete è un russo.

Re: Aplogruppo R1a KMS133

MessaggioInviato: lunedì 2 settembre 2019, 14:14
da Giovanni Maione
Giovanni Maione ha scritto:L'unico KMS133 che ho trovato in risorse disponibili in rete è un russo.

e un saudita (id:YF16366 in YFull).