Aplogruppo R1a KMS133

Moderatori: Alessio Bruno Bedini, Messanensis, GENS VALERIA

Aplogruppo R1a KMS133

Messaggioda Giovanni Maione » mercoledì 6 giugno 2018, 13:11

Arrivati oggi i risultati dell'Y-DNA: R1a KMS133
Ho fatto delle ipotesi, ma prima vorrei sapere se qualcuno di voi sa qualcosa in più su questa subclade.
Giovanni Maione
 
Messaggi: 36
Iscritto il: mercoledì 7 febbraio 2018, 18:11

Re: Aplogruppo R1a KMS133

Messaggioda Giovanni Maione » martedì 30 ottobre 2018, 18:53

Sotto: M417 > Z93 > KMS149
Esiste una subclade profonda KMS132 sotto KMS133, che non ho ancora testato.
ISOGG Haplogroup: R1a1a1b2 (not listed)
Position (hg19): 14593932
Position (hg38): 12482132

Forward Primer: KMS133_F CTGGGATTATAGGCCTGAGG
Reverse Primer: KMS133_R TGTAAAAAGACGGAAATTAGGTGG

Reference: KMS (Muratov et al.) (2014)
Giovanni Maione
 
Messaggi: 36
Iscritto il: mercoledì 7 febbraio 2018, 18:11

Re: Aplogruppo R1a KMS133

Messaggioda Nessuno » domenica 4 novembre 2018, 11:08

Molto interessante: pare che KMS133 sia condivisa soprattutto da persone di origine slava.
Nessuno
 
Messaggi: 234
Iscritto il: lunedì 9 febbraio 2009, 22:08

Re: Aplogruppo R1a KMS133

Messaggioda Giovanni Maione » domenica 4 novembre 2018, 14:36

L'unico KMS133 che ho trovato in risorse disponibili in rete è un russo.
Giovanni Maione
 
Messaggi: 36
Iscritto il: mercoledì 7 febbraio 2018, 18:11


Torna a Genealogia genetica - DNA



Chi c’è in linea

Visitano il forum: Nessuno e 2 ospiti